sort by

6 publications mentioning cel-mir-57

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-57. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 655
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-61, cel-mir-84, cel-mir-273
nob-1 is a direct target of mir-57 Given that miRNAs generally act by reducing gene expression and that overexpression of mir-57 produced tail defects similar to those of nob-1 reduction-of-function mutations, we reasoned that overexpression of mir-57 might inhibit nob-1 expression, and thus produce the observed Nob/Vab phenotypes. [score:15]
Although the nob-1 gene seems to be one direct target of mir-57, there are undoubtedly many other direct or indirect ones both within the AB sublineages where both mir-57 and nob-1 are expressed and also in the C lineage where mir-57 is found in the absence of nob-1. MirBase lists a total of 492 candidate targets for mir-57 [7], [34] but which of these might be functional targets in the C lineage is unclear. [score:12]
Given that miRNAs generally act by reducing gene expression and that overexpression of mir-57 produced tail defects similar to those of nob-1 reduction-of-function mutations, we reasoned that overexpression of mir-57 might inhibit nob-1 expression, and thus produce the observed Nob/Vab phenotypes. [score:12]
nob-1 downregulates mir-57 expressionGiven their similar expression patterns in the AB sublineages and the earlier onset of nob-1 expression compared to that of mir-57, we reasoned that nob-1 might be required for mir-57 expression. [score:11]
However, arrays lacking the LAG-1 site failed to express the reporter in the tail, whereas the wild type promoter yielded strong expression, indicating that mir-57 is likely a direct target of LAG-1. nob-1 is co-expressed with mir-57 spatially but with an earlier onsetIn addition to the Notch and Wnt pathways, the nob-1 gene, an ABd-B Hox gene homolog, is known to be involved in posterior pattern specification, with loss-of-function alleles resulting in embryonic lethality and larval arrest [22]. [score:10]
mir-57 promoter arrays produced overexpression and ectopic expression of mir-57 To test more directly the hypothesis that the injected mir-57 upstream sequence produces increased levels of mir-57 miRNA, we performed using a radioactive labeled LNA probe to detect the miRNA expression directly. [score:9]
By this hypothesis, mir-57 loss of function mutations might lead to increased expression of nob-1 although in contrast to the overexpression experiments, such an effect might be attenuated by other, redundant regulators of nob-1. In agreement with this, overexpression of nob-1 from an extrachrormosomal array partially mimics the phenotypes of mir-57 loss of function albeit at a lower level (Table S1, n = 3). [score:9]
Further support for mir-57 regulation of nob-1 comes from the fact that the mir-57 mutation partially alleviated the phenotypes of nob-1(ct230), a hypomorphic allele, presumably resulting from partial release of the repression of nob-1. Thus, in normal development, our data suggests that nob-1 expression begins by the 100-cell stage, activates mir-57 by the 200-cell stage, which in turn dampens the expression of nob-1, perhaps in conjunction with other miRNAs. [score:8]
However, arrays lacking the LAG-1 site failed to express the reporter in the tail, whereas the wild type promoter yielded strong expression, indicating that mir-57 is likely a direct target of LAG-1. In addition to the Notch and Wnt pathways, the nob-1 gene, an ABd-B Hox gene homolog, is known to be involved in posterior pattern specification, with loss-of-function alleles resulting in embryonic lethality and larval arrest [22]. [score:8]
This apparent position rather than tissue/cell dependent expression pattern and impact led us to examine its interactions with other genes known to be involved in posterior fate specification, including nob-1, vab-7, and members of the Wnt and Notch pathways, pop-1 and lag-1. Interactions of mir-57 and nob-1 mutants along with the presence of a putative mir-57 binding site in the 3′ UTR of a nob-1 isoform suggested that mir-57 might directly regulate nob-1 expression. [score:7]
As described above, expression of mir-57 was clearly present in the C lineage and only expressed in the E lineage after elongation (data not shown) so that spatial expression of nob-1 and mir-57 are not totally overlapping in these lineages 10.1371/journal. [score:7]
mir-57 is expressed in posterior cells across tissue typesWith the expectation that detailed expression analysis might suggest possible targets for mir-57, we began our investigation of the gene by determining its embryonic expression pattern with cellular resolution at one-minute time intervals [16], [17]. [score:7]
Quantification of mir-57 expressionTo test the effect of the predicted mir-57 target site within the nob-1 3′ UTR on the reporter expression, the pZZ1 construct was modified so that the let-858 3′ UTR was replaced with the 3′ UTR either from nob-1a or nob-1b by the following methods. [score:7]
However, we did not observe male tail defects in nob-1 overexpressing strains, suggesting that mir-57 may regulate male tail development independent of nob-1. The lower penetrance might reflect partial transmission of extrachromosomal array, alternatively, other targets of mir-57 may also contribute to the observed phenotypes. [score:7]
Taken together these results show that overexpression of mir-57 either from the arrays directly or from extra copies of the promoter region leading to the overexpression of the endogenous mir-57 gene can perturb posterior development and thus produce Vab/Nob phenotypes. [score:7]
The vab-7 gene, an even-skipped homolog, is expressed in the posterior of the embryo in regions overlapping with those expressing mir-57, as determined by automated lineage -based expression analysis of a vab-7 promoter::mCherry fusion integrated transgene (Figure S4, See Text S1). [score:7]
As described above, expression of mir-57 was clearly present in the C lineage and only expressed in the E lineage after elongation (data not shown) so that spatial expression of nob-1 and mir-57 are not totally overlapping in these lineages 10.1371/journal. [score:7]
More dramatically, reduced function of nob-1 delayed the onset and reduced the level of mir-57 expression and in turn, nob-1 is to be a direct target of and repressed by mir-57. [score:6]
These results strongly support the hypothesis that the array of the extra cis-regulatory fragments titrates out repressors controlling the endogenous expression of mir-57, thus increasing mir-57 expression. [score:6]
On the one hand, the Hox gene is required for normal activation of mir-57 expression, and on the other, the Hox gene functions as a direct target of and is repressed by the miRNA. [score:6]
The reduction in reporter construct expression was not observed in the absence of a functional mir-57 gene, indicating that nob-1 is a direct functional target of mir-57. [score:6]
nob-1 downregulates mir-57 expression. [score:6]
Given their similar expression patterns in the AB sublineages and the earlier onset of nob-1 expression compared to that of mir-57, we reasoned that nob-1 might be required for mir-57 expression. [score:6]
Based on the detailed expression map as well as their similar phenotypes, we examined the interaction between mir-57 and other genes implicated in posterior development in C. elegans including ­nob-1. The expression of mir-57 in the posterior sublineages of AB founder cells was dependent upon their proper specification through the Notch and Wnt pathways. [score:6]
These results suggest that mir-57 might be a direct target of one or more of these early regulators. [score:5]
The branch lengths (division timing) of nob-1 and mir-57 expressing trees are normalized against Sulston's lineage trees and the expression values are interpolated accordingly. [score:5]
It should be noted that mir-57 expression is very likely subject to control of positional cues other than nob-1 because expression onset of nob-1 seems synchronized but that for mir-57 are not (Figure 6). [score:5]
1001089.g006 Figure 6Embryonic lineage -based expression of nob-1. Shown are the superimposed lineage based expression trees between NOB-1::GFP (green) and mir-57::HIS-24:mCherry (red). [score:5]
In addition the expression of the mir-57 transgene required the presence of a binding site within its promoter sequence for the Notch pathway factor LAG-1, suggesting that the gene might be directly regulated by the pathway. [score:5]
To apply the system to miRNAs and to see how the information might yield insights into their function, we examined the expression patterns of several miRNA genes of unknown function and found that mir-57, a miRNA gene conserved from nematodes to mammals (where it is named miR-10) [7], produced a particularly intriguing expression pattern. [score:5]
mir-57 promoter arrays produced overexpression and ectopic expression of mir-57. [score:5]
Further, using a reporter to assay nob-1 expression, the loss of function mutation in mir-57 only produced modest effects on the nob-1 expression (Figure S9, See Text S1), suggesting the miRNA functions redundantly with other miRNAs or pathways. [score:5]
Using live cell imaging and automated expression analysis, we found a miRNA gene, mir-57, is expressed in a position rather than tissue dependent way. [score:5]
In lineages expressing both genes, such as the ABpl/rpppp lineages, nob-1 signal appears a full cell cycle before the onset of mir-57 expression. [score:5]
Despite the striking overlap of expression between mir-57 and nob-1 in the AB sublineages, their temporal expression patterns are quite different. [score:5]
The detailed analysis of the expression pattern of mir-57 and nob-1, coupled with the phenotypes observed in the absence and overexpression of mir-57 demonstrate that the miRNA gene plays a role in combination with the posterior Hox gene to specify posterior identity. [score:5]
In summary, the spatial correlation observed between mir-57 expressing cells in embryos and the defects associated with its loss of function suggests a likely role of mir-57 in regulating posterior cell fate specification in development. [score:5]
In the C lineage, mir-57 expression is dependent on the cell fates specified by PAL-1 as against the gene completely abolished the mir-57 expression with concomitant cell fate changes as judged by the loss of asymmetry of cell cycle timing between Cxa and Cxp (Figure S8). [score:5]
With the expectation that detailed expression analysis might suggest possible targets for mir-57, we began our investigation of the gene by determining its embryonic expression pattern with cellular resolution at one-minute time intervals [16], [17]. [score:5]
One explanation of this suppression of the hypomorphic nob-1 mutant is that the deletion of mir-57 prevents repression of nob-1 expression, partially restoring nob-1 activity in the mutant. [score:5]
By investigating interactions between genes of these classes expressed in mir-57 expressing cells, we demonstrated by both genetic analysis and gene expression assays that a negative feedback loop between a posterior Hox gene, nob-1, and mir-57 regulates posterior cell fate determination in C. elegans. [score:5]
To confirm that the expression patterns of the promoter-reporter fusion reflect those of the native mir-57 expression, we performed in situ hybridization on whole mounted embryos using an LNA -modified probe. [score:5]
To test the effect of the predicted mir-57 target site within the nob-1 3′ UTR on the reporter expression, the pZZ1 construct was modified so that the let-858 3′ UTR was replaced with the 3′ UTR either from nob-1a or nob-1b by the following methods. [score:5]
Therefore, the tail defects can arise either from ectopic expression of mir-57 driven by vab-7 promoter or its overexpression produced by the action of other sequences/elements in the 2.26 kb mir-57 promoter. [score:5]
To test more directly the hypothesis that the injected mir-57 upstream sequence produces increased levels of mir-57 miRNA, we performed using a radioactive labeled LNA probe to detect the miRNA expression directly. [score:5]
To explore this possibility, we profiled the expression of nob-1 with resolution comparable to that of mir-57 by automated lineage -based expression analysis using an integrated NOB-1::GFP protein fusion transgene (see ). [score:5]
Computational analysis revealed the presence of a putative LAG-1 binding motif 55 bp upstream of the mir-57 mature sequence (Figure 2A), suggesting that lag-1 might directly regulate mir-57 expression. [score:5]
NOB-1 expression in N2 background is shown as green and the expression in mir-57 deletion background (VC347) as red. [score:5]
Sited directed removal of a putative mir-57 binding site within the nob-1b 3′ UTR was performed in the similar way as that used for LAG-1 site-directed mutation described above and was termed as nob-1 bm hereafter. [score:4]
Shown are boxplots of tail expression intensities derived from three different 3′ UTRs: nob-1b, nob-1bm (nob-1b UTR with site-directed removal of the binding site), nob-1a injected into wild type (wt, first three columns) or mir-57 mutant (Δ last three columns) animals as indicated (See ). [score:4]
Genetic analysis of a deletion mutant and overexpressing lines of mir-57 supported its role in the development of the tail of the animal. [score:4]
nob-1 is a direct target of mir-57. [score:4]
The results suggest that the Nob/Vab phenotypes produced by overexpression of mir-57 are likely caused at least in part by down regulation of nob-1 activities within the posterior region, mimicking those of hypomorphic or null nob-1 mutants. [score:4]
The AB sublineage division patterns resembled those of wild type but the mir-57 reporter expression onset was delayed and expression level in the AB sublineages was significantly reduced (n = 6, p<0.01, Student's t test) compared to untreated animals (Figure 7), suggesting that mir-57 activity is at least partially dependent on nob-1 activity in these lineages. [score:4]
We postulated that the high copy number of the mir-57 promoter fragment could have disrupted normal regulation of the genomic copy of mir-57, possibly titrating out an important inhibitory factor. [score:4]
Given the relatively late stage of mir-57 expression during embryogenesis, we traced the relevant embryonic lineage until the last round of cell division in both “forward” and “backward” directions. [score:4]
Taken together, by using the automatic high-resolution gene expression technology, we were able to identify a negative regulatory loop between mir-57 and a Hox gene to control regional identity. [score:4]
The mir-57 gene is expressed in posterior sublineages in the posterior regions of the animal. [score:3]
A total of six and four embryos were profiled for mir-57 and nob-1 expressing embryos respectively. [score:3]
To profile the mir-57 expression after the against nob-1, the embryos were mounted 24 hours after their parents were injected and imaged for six hours at room temperature. [score:3]
Phenotypes associated with mir-57 loss of function and misexpression. [score:3]
Figure S8RNAi against pal-1 altered the mir-57 expression in C lineage. [score:3]
Our results provide direct evidence that injection of either the mir-57 genomic region including its mature sequence and flanking sequences or the promoter region of mir-57 alone produced overexpression of the miRNA, which likely underlies the tail defects associated with these assays. [score:3]
Similarly, the Emb phenotype observed for the mir-57 null mutant at 26°C could be partially reproduced by nob-1 overexpression. [score:3]
To test this hypothesis, we depleted nob-1 activity by and observed its effects on the mir-57 reporter expression with time using automated lineaging. [score:3]
Figure S9Effects of mir-57 loss of function on the NOB-1 expression. [score:3]
Nonetheless, the dependence of the resultant phenotypes on the presence of a functional copy of the mir-57 gene, either in cis or in the genome, argues that the presence of the fragment in high copy number results in mir-57 misexpression. [score:3]
No defects were seen in the anterior body of either hermaphrodites (112) or males (n = 320) that carry the arrays, consistent with the expression patterns of mir-57. [score:3]
To examine the cell patterning defects in the tail, we injected the mir-57 promoter (a 2260 bp fragment upstream from the miRNA mature sequence, see below) into a strain expressing hypodermal marker, ajm-1::GFP. [score:3]
We looked genetically for further support that nob-1 is a target of mir-57. [score:3]
Embryonic lineaging analysis and expression profiling of mir-57 was performed with strain RW10048 using StarryNite and AceTree as described [17], [36] with modifications. [score:3]
1001089.g005 Figure 5Northern blot results for mir-57 overexpression. [score:3]
Strain RW10048 was used for profiling of mir-57 expression. [score:3]
Shown are the notched boxplots of NOB-1 expression in the presence and absence of mir-57. [score:3]
Stably integrated lines with a 2.26 kb fragment upstream of the mir-57 mature sequence fused with a fluorescent reporter mCherry [18] showed expression in the posterior cells of the embryo in a variety of tissues (Figure 1). [score:3]
mir-57 is expressed in posterior cells across tissue types. [score:3]
Interactions of mir-57 with other factors involved in posterior patterningBecause these results implicate mir-57 in posterior development, we examined its relationship to other genes with a known role in posterior embryonic development in C. elegans. [score:3]
A caveat for these experiments, however, is that all DNA constructs contained a mir-57 promoter introduced by microinjection, which as we described above leads to overexpression of mir-57. [score:3]
The nob-1 reporter appears at about the 100-cell stage with a fairly uniform time of onset in different cells whereas mir-57 expression mostly appears after the 200-cell stage, although the more posterior the cells are, the earlier onset is detected. [score:3]
Therefore, we examined the phenotypic effects of mir-57 overexpression. [score:3]
Figure S7 mir-57 expression is dependent on the lineage fate. [score:3]
mir-57 expression is abolished in both lineages. [score:3]
To test the first possibility, we drove mir-57 expression by a vab-7 promoter. [score:3]
1001089.g001 Figure 1The mir-57 gene is expressed in posterior sublineages in the posterior regions of the animal. [score:3]
The ability of the p vab-7:: mir-57 arrays to partially mimic the phenotypes also implies that overexpression of mir-57 is the primary cause for the observed defects. [score:3]
1001089.g004 Figure 4Hypodermal defects associated with mir-57 overexpression. [score:3]
Shown are the superimposed lineage based expression trees between NOB-1::GFP (green) and mir-57::HIS-24:mCherry (red). [score:3]
Figure S2 mir-57 expression in adult male tail. [score:3]
The altered expression of mir-57 after against nob-1 is similarly plotted (red). [score:3]
For example, both mir-57 and nob-1 are expressed in the same AB sublineages, ABpl(r)ap and ABpl(r)pp, which give rise to a variety of tissue/organ types in the posterior region, the region where the abnormal phenotypes were observed. [score:3]
Quantification of mir-57 expression. [score:3]
We speculate that the difference in the details of the phenotypes results from the differences in vab-7 expression pattern from that of the mir-57 promoter. [score:3]
mir-57 overexpression from extrachromosomal arrays resulted in Nob (C,D) and Vab-like (E) tail phenotypes as indicated by arrowheads. [score:3]
A hypomorphic allele, ct230, produces both Nob and Vab phenotypes quite similar to those that result from mir-57 overexpression, suggesting that the mir-57 and nob-1 might function in the same pathways. [score:3]
Effect of nob-1 on the expression of mir-57. [score:3]
An intact mir-57 structural gene is required for producing Nob/Vab phenotypesThe tail defects associated with the mir-57 arrays could derive either from elevated expression of the transgene or from the action of other sequences/elements in the 2.26 kb construct, which contains several regions conserved in C. briggsae (Figure 2). [score:3]
Thus, in all these cases, mir-57 expression is dependent on the lineage fates and thus likely downstream of these decisions. [score:3]
1001089.g003 Figure 3Phenotypes associated with mir-57 loss of function and misexpression. [score:3]
Both the tail defects and the paucity of sperm likely contribute to the inability of mir-57 overexpressing males to produce progeny. [score:3]
Similarly, against lag-1, a gene involved in Notch signaling, converts ABplap and ABplpp to ABalap and ABarpp fates respectively with concomitant loss of mir-57 expression in these altered lineages (Figure S7). [score:3]
After the embryonic cell lineage was produced for both mir-57 and nob-1 expressing strains, pixel densities from GFP (nob-1) or RFP (mir-57) channel were extracted and aligned against the lineage tree branch for each time point and all nuclei. [score:3]
Strains carrying the mir-57 promoter fused to a red fluorescent reporter, mCherry, showed the gene is exclusively expressed in the posterior sublineages of ABp(l/r)(a/p)p and a variety of sublineages of the C founder cell. [score:3]
Note the mir-57 expressing cells are clustered within the posterior region of embryo. [score:3]
The residual expression of mir-57 might reflect the incomplete penetrance of the. [score:3]
The is quite effective as evidenced by the complete homeotic lineage fate transformation from MS to E. These results indicate that the correct expression of mir-57 is dependent on the lineage fate specified by the Wnt signaling pathway. [score:3]
An approximately 350 celled embryo was photographed for mir-57 expression in both wild type background animals (A–C) and those carrying the mir-57 promoter array (D–F). [score:3]
Figure S1 mir-57 shows expression in a variety of cell types in the posterior sublineages. [score:3]
In the wild type background, the arrays, because they contain the mir-57 promoter region, should result in overexpression of mir-57 from the genomic copy. [score:3]
To explore experimentally the functional role of the mir-57 binding site, we used mir-57 promoter driven reporter constructs followed by nob-1 3′ UTRs to induce strong overexpression of the endogenous mir-57 in order to produce a robust effect. [score:3]
Hypodermal defects associated with mir-57 overexpression. [score:3]
The mir-57 overexpression construct is a 2494 bp PCR product that includes 2260 bp promoter sequences and the 234 bp stem-loop and its downstream sequence. [score:3]
Other factors such as PAL-1 may be involved in the control of mir-57 expression in this sublineage (Figure S4 and Figure S8). [score:3]
Because these results implicate mir-57 in posterior development, we examined its relationship to other genes with a known role in posterior embryonic development in C. elegans. [score:3]
The tail defects associated with the mir-57 arrays could derive either from elevated expression of the transgene or from the action of other sequences/elements in the 2.26 kb construct, which contains several regions conserved in C. briggsae (Figure 2). [score:3]
1001089.g008 Figure 8Validation of nob-1 as a target of mir-57. [score:3]
Figure S6Injection of mir-57 promoters caused earlier onset and ectopic expression (more anterior) of mir-57 in the embryo. [score:3]
Validation of nob-1 as a target of mir-57. [score:3]
Figure S3Adult male phenotypes associated with mir-57 overexpression. [score:3]
results for mir-57 overexpression. [score:3]
nob-1 is co-expressed with mir-57 spatially but with an earlier onset. [score:3]
1001089.g007 Figure 7Effect of nob-1 on the expression of mir-57. [score:3]
against nob-1 did not affect mir-57 expression in the C lineage (data not shown). [score:3]
against pop-1 produced homeotic lineage fate transformation, i. e., from ABplap into ABplpp (A,F) and MS into E like lineage (C, data not shown) (the later transformation serves as a reference for the effectiveness) while mir-57 expression and lineage fate remained unchanged in ABplpp (B,G). [score:3]
The reporter was detectable from roughly the 100-cell stage in posterior progeny of ABp(l/r)pp and ABp(l/r)ap, the same sublineages in which mir-57 is also expressed (Figure 6). [score:3]
Thus, these results may exaggerate the effects of a more physiological level of mir-57 expression, but the results clearly show that the binding site is functional in vivo. [score:3]
Because we had also observed expression of mir-57 in the adult male tail, we wondered if the male tail morphology might be a more sensitive assay for mir-57 activity. [score:2]
mir-57 regulates posterior patterning. [score:2]
As a potentially more sensitive test of the interaction at more physiological levels, we constructed doubly mutant mir-57(gk175); nob-1(ct230) animals, postulating that if mir-57 normally is responsible for down regulation of nob-1 activity, removal of mir-57 activity might ameliorate the effects of the hypomorphic allele. [score:2]
Perhaps the nob-1 hypomorphic allele creates a sensitized background, exaggerating the impact of mir-57 loss of function, even in the presence of other factors redundantly regulating nob-1 activities. [score:2]
To build the construct with site directed removal of LAG-1 site within the mir-57 promoter, the fragments flanking LAG-1 site were PCR amplified from pZZ1 and fused together by PCR. [score:2]
Note, mir-57 overexpressing animals develop few tail rays and produced only a few sperms (B) compared to N2 (A) animals as indicated by arrow head. [score:2]
mir-57 regulates posterior patterningTo gain insight into the possible functional roles of mir-57, we examined animals homozygous for a presumptive null allele, gk175, a 414 bp deletion that removes the entire stem loop structure of the miRNA (Figure 2A). [score:2]
In addition, injection of the regulatory region alone (−2260 to −63) into the wild type animals also produced high levels of the miRNA transcripts, comparable to that seen for injections with the full mir-57 region (Figure 5, Table 2). [score:2]
Compared to wild type (A), the treatment abolished the fate asymmetry between C derived hypodermis and body wall muscle as well as mir-57 expression (B). [score:2]
Next, to observe directly the effects of the mir-57 extrachromosomal arrays on the activity of a genomic copy of the mir-57 promoter, we introduced the mir-57 promoter array into a background containing the integrated mir-57::mCherry reporter construct. [score:2]
We made three constructs: two of them using the 3′ UTRs from the different splice isoforms, nob-1a and nob-1b and a third construct using the 3′ UTR from nob-1b in which the candidate mir-57 binding site was removed by site-directed mutagenesis (See ). [score:2]
To test the hypothesis, we produced a modified mir-57::HIS-24::mCherry fusion construct with the LAG-1 site removed by site-directed mutagenesis and used it to generate transgenic lines by microinjection. [score:2]
Importantly, a control construct with a mutated mature sequence of mir-57 produced no Vab/Nob animals (n = 347, Table 2), indicating that presence of mir-57 structural gene on the array is essential for the development of tail defects. [score:2]
DIG labeled LNA -modified probe complementary to the mature mir-57 was made by Exiqon with the sequence ACACACAGCTCGATCTACAGGGTA. [score:1]
Genotype mir-57(gk175) N2 Emb(%) Lav(%) Ste (%) Emb(%) Lav(%) Ste (%) 15°C 1.6(514) 0.5(325) 2.7(339) 1.2(277) 0.8(363) 0(710) 20°C 1.3(840) 2.0(359) 5.3(472) 0.7(647) 0.5(451) 1.2(389) 26°C 6.7(892) 5.6(841) 32.1(978) 1.3(360) 1.5(399) 5.7(451) Number of worms scored is indicated in parentheses. [score:1]
A predicted LAG-1 binding site 55 bp upstream of the mir-57 mature RNA is shown as a solid black circle. [score:1]
The left two of experiments contrast the phenotypes of nob-1(ct230) and nob-1(ct230); mir-57(gk175), whereas the right two contrast nob-1(RNAi); and nob-1(RNAi); mir-57(gk175). [score:1]
Genetic interactions between nob-1 and mir-57. [score:1]
For mir-57 animals, the ray number was counted on both room temperature and 26°C. [score:1]
Although mir-57 is not found within a Hox gene cluster, Hox genes in C. elegans are only relatively loosely clustered [32]. [score:1]
Because the loss-of-function allele for mir-57 only produced moderate defects in embryos and the larval tail, we reasoned that the effect of the allele is possibly masked by other miRNAs or factors that function redundantly with mir-57. [score:1]
Note: mir-57 expression in ABplap becomes characteristic of that of ABplpp (A,F,G). [score:1]
Thus, the abnormal tail phenotypes produced by the mir-57 promoter fragment require at least one functioning copy of the mir-57 structural gene. [score:1]
However, the absence of the genomic mir-57 gene completely abolished the Vab and Nob phenotypes produced by the mir-57 promoter fragment (Table 2), showing these effects required the presence of an intact copy of mir-57 either in the genome or on the array. [score:1]
The same array as that used in (a) was crossed into mir-57 mutant animals (c). [score:1]
The constructs for site-directed removal of the LAG binding site and the mutated mir-57 as well as for the hybrid construct between mir-57 and vab-7 promoter, were built by the fusion PCR technique as described below [35] (See Text S1 for the primers used). [score:1]
The mature ­mir-57 sequence is highlighted in red. [score:1]
The mir-57 promoter only PCR product (−2260 to −63) was also injected into both wild type and mir-57 deletion animals in the same concentrations. [score:1]
This would be consistent with the 2.2 kb fragment binding and titrating out a repressor of mir-57 but what that factor might be remains unknown. [score:1]
No signal was detected for mir-57 deletion strain. [score:1]
An intact mir-57 structural gene is required for producing Nob/Vab phenotypes. [score:1]
Deletion of genomic mir-57 increases nob-1b transcripts about two-fold while no effects were observed for nob-1a transcript level. [score:1]
Deletion of mir-57 significantly increases the nob-1b transcript level (p<0.01, Student's t test, Figure 9A) and mir-57 promoter arrays in the N2 background significantly decrease its transcript level, roughly four fold (p<0.05, Student's t test, Figure 9A). [score:1]
Four strains were used for total RNA extraction using RNeasy Fibrous Tissue Mini Kit (Cat # 74704): N2, VC347(mir-57(−/−)), as well as the above two strains injected with mir-57 promoter. [score:1]
The region containing the mir-57 gene is expanded below, showing the mature miRNA (green) within the predicted stem-loop region (black bar). [score:1]
To quantify the change of nob-1 transcript in the presence and absence of ­genomic mir-57, we performed Real-time RT-PCR using LightCycler (Roche) with QuantiTect SYBR Green Kit (Cat # 204143) and QuantiTect Reverse Transcription Kit (Cat # 205311). [score:1]
As expected, both wild type and mir-57 mutant animals injected with the full genomic region of mir-57 (−2260 to +234) showed much higher levels of the miRNA transcripts, i. e., about 5 times higher than that of the un -injected controls. [score:1]
Interactions of mir-57 with other factors involved in posterior patterning. [score:1]
The fragment containing P mir-57::HIS-24::mCherry was PCR amplified from pZZ1. [score:1]
by injection against nob-1 was performed as described previously for N2 and mir-57 mutant animals. [score:1]
The ability of the 2.26 kb sequence upstream of the mature mir-57 miRNA to produce Vab/Nob phenotypes is intriguing. [score:1]
The mature mir-57 sequences are highlighted in red. [score:1]
The mature sequences of mir-57 are identical between C. elegans and C. briggsae (Figure 2B and 2C). [score:1]
To build the hybrid construct between mir-57 and vab-7 promoter, the 3400 bp vab-7 promoter was fused with 284 bp mir-57 stem-loop plus its flanking sequences. [score:1]
mir-57(gk175) animals injected with the same fragment also produced a comparable frequency of Vab progeny (Table 2). [score:1]
1001089.g009 Figure 9Genetic interactions between nob-1 and mir-57. [score:1]
The extrachromosomal arrays of the transgenic animals were crossed into the mutant mir-57(gk175) background and genotyped by single worm PCR. [score:1]
Note the mir-57 mature sequences are identical between the two species. [score:1]
In order the lanes show wild type; the mir-57 deletion strain; animals with transgenic arrays of the mir-57 genomic fragment in the wild type background; animals with transgenic arrays of the with mir-57 genomic fragment in the mir-57 deletion background; and finally animals with arrays of the mir-57 promoter in a wild type background. [score:1]
nob-1(ct230) and mir-57(gk175) double mutant was made by crossing and genotyped by single worm PCR. [score:1]
The mir-57 promoter only construct is the PCR product that is -2260 to -63 bp from the mir-57 mature sequence. [score:1]
Arrays of the mir-57 genomic fragment into both wild type and the mir-57 deletion mutant resulted in elevated levels of the mir-57 miRNA. [score:1]
The mir-57 antisense LNA probe and U-6 antisense probe (GTCATCCTTGCGCAGGGGCCATGCTAATCTTCTCTGTATTGTTCCAAT) were 5′ labeled with γ- [32]P ATP. [score:1]
This is supported by the evidence that mir-57 promoter injection produced a significant decrease of nob-1b, but not nob-1a, transcripts (Figure 9A). [score:1]
Arrays of mir-57 promoter alone in the wild type background produced mir-57 miRNA levels similar to that seen using the intact mir-57 region. [score:1]
[b]Coordinates in base pairs relative to the start of the mature mir-57 sequence. [score:1]
The nob-1b transcript level is roughly four-fold lower in mir-57 promoter-array wild type strain (+) than that in wild type only (−). [score:1]
Extrachromosomal arrays of the p vab-7:: mir-57 construct produced Vab/Nob animals, albeit at a lower rate than the native mir-57 promoter. [score:1]
These constructs were introduced into the wild type N2 background by microinjection to create extrachromosomal arrays, which were then crossed into the mir-57 deletion background. [score:1]
The mir-57 locus and its predicted stem loop sequences. [score:1]
Vab or Nob (data not shown) phenotypes were scored for nob-1(ct230), nob-1(ct230) and mir-57(gk175) double, nob-1(RNAi), nob-1(RNAi) and mir-57(gk175) double animals. [score:1]
Consistent with this, the nob-1b 3′ UTR, one of the two alternative nob-1 3′ UTRs, contains a predicted mir-57 binding site [7] (Figure 8A and 8B). [score:1]
Our combined results from functional assays provide support for a negative regulatory loop between the miRNA and Hox gene, giving mir-57 an important role in posterior fate determination. [score:1]
A 2260 bp (−2260 to −1) fragment upstream of mir-57 was cloned into the restriction sites upstream of a HIS-24::mCherry cassette using AvrII and SmaI sites in the pJM20 vector [17] to give rise to pZZ1. [score:1]
The sequences are fused with mir-57 genomic region (−50 to 234 bp relative to the start of mature mir-57 sequence). [score:1]
Promoter miRNA Position Lines Vab/Nob% Background mir-57 mir-57 −2260 to 234 b 829.3(625 d) wild type mir-57 none−2260 to −63 b 5 33.9(373) wild type mir-57 mir-57 −2260 to 234 b 2 36.4(522) mir-57(gk175) mir-57 none−2260 to −63 b 6 0(583) mir-57(gk175) vab-7 mir-57 −3664 to 36 c 3 11.3(362) wild type vab-7 mir-57m a −3664 to 36 c 7 0(347) wild type vab-7 none−3664 to 36 c 5 0(831) wild type [a]Mutated mir-57 mature sequence (see ). [score:1]
The fraction of nob-1 mutant animals exhibiting abnormal tail phenotypes is reduced in both cases by the removal of the genomic mir-57. [score:1]
To gain insight into the possible functional roles of mir-57, we examined animals homozygous for a presumptive null allele, gk175, a 414 bp deletion that removes the entire stem loop structure of the miRNA (Figure 2A). [score:1]
Phenotypes of mir-57 transgenic arrays. [score:1]
Genetic interaction between nob-1 and mir-57. [score:1]
No signals were detected for the mir-57 deletion strain (Figure 5). [score:1]
The mir-57 reporter (red, or yellow when co-localized with green) is detected only in the posterior cells of the embryo. [score:1]
Genetic interaction between nob-1 and mir-57 nob-1(ct230) and mir-57(gk175) double mutant was made by crossing and genotyped by single worm PCR. [score:1]
Figure S5Other posterior defects associated with injection of fusion between vab-7 promoter and mir-57 stem loop sequences. [score:1]
Vab tails are caused by mir-57 promoter array. [score:1]
We used against genes of the Notch and Wnt pathways that specify cell lineage fates to look more broadly for interactions between these pathways and mir-57. [score:1]
Quantification of nob-1 transcriptTo quantify the change of nob-1 transcript in the presence and absence of ­genomic mir-57, we performed Real-time RT-PCR using LightCycler (Roche) with QuantiTect SYBR Green Kit (Cat # 204143) and QuantiTect Reverse Transcription Kit (Cat # 205311). [score:1]
The fertility of the mir-57 males was examined in a similar fashion but only the presence of male progeny was examined. [score:1]
Like many miRNA genes, mir-57 most likely functions redundantly with other miRNA genes. [score:1]
Notably, the closest homolog to mir-57 in other species is the broadly conserved gene miR-10 [7]. [score:1]
Homozygous mir-57(gk175) animals placed at 26°C occasionally had preanal bulges (arrowhead in (A)) or vacuolated cells (arrow in (B)) in the tail. [score:1]
As expected, deletion of mir-57 had no effect on the nob-1a transcript, which does not contain a mir-57 binding site. [score:1]
1001089.g002 Figure 2The mir-57 locus and its predicted stem loop sequences. [score:1]
The marker showed that the hypodermal cells are severely disorganized in the tails of Nob/Vab animals as opposed to those in uninjected control animals (Figure 4), supporting a role of mir-57 in patterning posterior cells. [score:1]
The presence of ­ mir-57(gk175) allele was followed by single worm PCR. [score:1]
The putative binding site for mir-57 has the highest score among all the predicted miRNA binding sites within the nob-1 3′ UTR [7]. [score:1]
A putative mir-57 binding site within the nob-1b UTR is shown as a white star. [score:1]
Therefore, we introduced both the full length and truncated arrays into a background containing the genomic mir-57 deletion allele, gk175. [score:1]
Surprisingly, injection of fragments (−2260 to −63) lacking the transcribed portion of mir-57 and a predicted upstream LAG-1 binding site yielded a comparable fraction of animals with abnormal tails (Table 2). [score:1]
The number of the tail rays was counted only on one side of the male tails from both N2 (n = 57), mir-57(gk175) (n = 32) and the mir-57 promoter array containing animals (n = 38). [score:1]
[1 to 20 of 215 sentences]
2
[+] score: 10
UV: For the UV -treated samples, we chose mir-57-5p as highly expressed (215390,119 reads), mir-55-3p as intermediately expressed (8240,595 reads) and mir-357-3p as lowly expressed (1289,386 reads) to validate by qPCR (Figure 4). [score:7]
mir-57-5p, mir-55-3p and mir357-3p are stable upon UV treatment, III. [score:1]
The detected Cq (Quantification cycle) values for all but one (mir-57-5p) of the above miRNAs correlated with the read counts obtained by RNA-seq. [score:1]
mir-57-5p is found to be more abundant than mir-55-3p in UV -treated samples when tested by qPCR, probably due to RNA-seq inaccuracy (Figure 4). [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 6
L) Expression of the mir-57 promoter is lost, reduced or delayed with pop-1, sys-1 and lit-1 RNAi. [score:3]
Since mir-57 is not expressed in ABa, some lineages were only partially edited. [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 3
Among the dysregulated miRNAs, the further bioinformatics analysis demonstrated that lin-4, mir-228, mir-249, mir-47, mir-355, mir-45, mir-2210, mir-57, mir-1018, mir-360, mir-64, mir-2209, mit-793, mir-1830, mir-2210, mir-83, mir-789, and mir-806 might be involved in the control of MWCNTs toxicity through affecting the functions of identified dysregulated genes in exposed nematodes (Table S6). [score:3]
[1 to 20 of 1 sentences]
5
[+] score: 3
Selected pha-4 (+) and mir-57 (+) enrichments mentioned in the text are boxed in red and blue, respectively Our smallest fraction was the ceh-6(+);hlh-16(+) double -positive cells, which consists of only four cells: the excretory duct and pore cells (which are single-celled epithelial tubes), and DB1 and DB3 motorneurons (Additional file 2: Figure S1). [score:1]
For example, the mir-57(+) fraction, which preferentially contains hypodermal cells, was enriched for the anatomy term “hypodermis” and the GO terms “structural constituent of cuticle” and “extracellular region,” consistent with the role of hypodermal cells in secreting the cuticular exoskeleton [38]. [score:1]
Selected pha-4 (+) and mir-57 (+) enrichments mentioned in the text are boxed in red and blue, respectivelyOur smallest fraction was the ceh-6(+);hlh-16(+) double -positive cells, which consists of only four cells: the excretory duct and pore cells (which are single-celled epithelial tubes), and DB1 and DB3 motorneurons (Additional file 2: Figure S1). [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 1
Levels of miRNAs cel-miR-241, cel-miR-53, cel-miR-57 and cel-miR-228 were decreased in day 8 in WT compare to day 1 levels, but failed to so in eat-2(ad1116) (Cluster E). [score:1]
[1 to 20 of 1 sentences]