Stem-loop sequence osa-MIR5809

AccessionMI0019826 (change log)
DescriptionOryza sativa miR5809 stem-loop
Literature search

2 open access papers mention osa-MIR5809
(2 sentences)

Stem-loop 
   guaaac   --   a  -a         agaa 
5'       gcu  ggu gc  gcggcgacg    u
         |||  ||| ||  |||||||||    a
3'       cga  cca cg  cgcugcugc    g
   -caaca   ca   g  gc         ggua
Get sequence
Deep sequencing
19 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 23527607-23527669 [-]
intergenic
Database links

Mature sequence osa-miR5809

Accession MIMAT0023281
Sequence

39 -  

ucgucgccggcgaccacagc

 - 58

Get sequence
Deep sequencing17 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).