![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR399h |
||||||||
Accession | MI0001060 (change log) | |||||||
Description | Oryza sativa miR399h stem-loop | |||||||
Gene family | MIPF0000015; MIR399 | |||||||
Literature search |
![]()
60 open access papers mention osa-MIR399h | |||||||
Stem-loop |
cca a c ------------c g 5' ugcauu cugggcaggucucc uuggcaguggc gauc a |||||| |||||||||||||| ||||||||||| |||| g 3' acguaa gacccguucagagg aaccgucaccg cuag c uag c a aaaacgcaccaaa u |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Comments |
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence osa-miR399h |
|
Accession | MIMAT0000991 |
Sequence |
69 - ugccaaaggagacuugcccag - 89 |
Deep sequencing | 7 reads, 2 experiments |
Evidence | by similarity; MI0001023 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|