Stem-loop sequence osa-MIR396c

Accession

MI0001048 (change log)

Description

Oryza sativa miR396c stem-loop

Gene family

MIPF0000047; MIR396

Literature search

57 open access papers mention osa-MIR396c
(157 sentences)

Stem-loop

   u     gc                   a     -     --g    a   -----a     auu    ga  gau 
5'  gccau  cuuuccacagcuuucuuga cuucu cuugu   ccuc cuc      cuuuc   acug  ga   a
    |||||  ||||||||||||||||||| ||||| |||||   |||| |||      |||||   ||||  ||    
3'  cggua  gaagggugucgaaagaacu ggaga gaacg   ggag ggg      gaagg   ugac  cu   u
   a     aa                   g     a     uga    a   auauuc     ---    ua  acg 

Deep sequencing

425 reads, 150 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1].

Genome context

• Coordinates (MSU7): Chr2: 34287873-34288013 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR396c

• osa-MIR396c: Chr2: 34287873-34288013 [-]
• osa-MIR396a: Chr2: 34280384-34280537 [+]

Database links

• miRBase Tracker:MI0001048

Mature sequence osa-miR396c-5p

• Accession: MIMAT0000979
• Previous IDs: osa-miR396c
• Sequence: 11 - uuccacagcuuucuugaacuu - 31
• Deep sequencing: 144 reads, 2 experiments
• Evidence: by similarity; MI0001014
• Database links:
  • RNAcentral:URS00001D441B_39947

Mature sequence osa-miR396c-3p

• Accession: MIMAT0022865
• Sequence: 113 - ggucaagaaagcugugggaag - 133
• Deep sequencing: 280 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS0000501BC6_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).