Stem-loop sequence osa-MIR396a

Accession

MI0001046 (change log)

Description

Oryza sativa miR396a stem-loop

Gene family

MIPF0000047; MIR396

Literature search

56 open access papers mention osa-MIR396a
(146 sentences)

Stem-loop

        ug  c            c         acgcaugaugaauaaucccuuugguuaauugugaucuggucucu 
5' cuuug  au uuccacagcuuu uugaacugc                                            g
   |||||  || |||||||||||| |||||||||                                             
3' gagac  ua agggugucgaaa aacuugacg                                            a
        gu  a            u         agagagacuacgguuacguuggcuagcucagauugaugcuagag 

Deep sequencing

160 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1].

Genome context

• Coordinates (MSU7): Chr2: 34280384-34280537 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR396a

• osa-MIR396a: Chr2: 34280384-34280537 [+]
• osa-MIR396c: Chr2: 34287873-34288013 [-]

Database links

• miRBase Tracker:MI0001046

Mature sequence osa-miR396a-5p

• Accession: MIMAT0000977
• Previous IDs: osa-miR396a
• Sequence: 11 - uuccacagcuuucuugaacug - 31
• Deep sequencing: 144 reads, 2 experiments
• Evidence: by similarity; MI0001013
• Database links:
  • RNAcentral:URS000039FDDC_39947

Mature sequence osa-miR396a-3p

• Accession: MIMAT0022863
• Sequence: 126 - guucaauaaagcugugggaa - 145
• Deep sequencing: 16 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS00001C1987_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).