Stem-loop sequence osa-MIR395a

AccessionMI0001042 (change log)
Previous IDsosa-MIR395c
DescriptionOryza sativa miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

40 open access papers mention osa-MIR395a
(185 sentences)

Stem-loop 
   u    c             u   uc       --   g      au    --a        u c  ug  cu   a 
5'  uguc acuggaguucucc caa  cacuuca  gua auagcu  ggcu   ggccucau g au  ca  guu c
    |||| ||||||||||||| |||  |||||||  ||| ||||||  ||||   |||||||| | ||  ||  |||  
3'  acag ugaccucaagggg guu  gugaagu  uau uaucga  ucga   ccggggua c ua  gu  caa a
   c    u             -   -c       ga   g      --    aaa        - -  gu  --   u
Get sequence
Deep sequencing
24 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 31805494-31805635 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395a
osa-MIR395aChr4: 31805494-31805635 [-]
osa-MIR395bChr4: 31805334-31805419 [-]
osa-MIR395cChr4: 31805193-31805281 [-]
osa-MIR395dChr4: 31805055-31805142 [-]
osa-MIR395eChr4: 31804912-31804999 [-]
osa-MIR395fChr4: 31804774-31804855 [-]
osa-MIR395gChr4: 31804633-31804718 [-]
Database links

Mature sequence osa-miR395a

Accession MIMAT0000973
Previous IDsosa-miR395c
Sequence

112 -  

gugaagugcuugggggaacuc

 - 132

Get sequence
Deep sequencing24 reads, 2 experiments
Evidence experimental; Illumina [3]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).
3
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).