Stem-loop sequence osa-MIR2868

AccessionMI0013030 (change log)
DescriptionOryza sativa miR2868 stem-loop
Stem-loop
   -------ucu   g                        ugccc 
5'           uuu uccuugguuuuguguaguagaaaa     a
             ||| ||||||||||||||||||||||||      
3'           aaa aggaaccaaaacacguuaucuuuu     c
   auacacaugu   g                        uacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 17938270-17938350 [+]
intergenic
Database links

Mature sequence osa-miR2868

Accession MIMAT0013815
Sequence

11 - 

uugguuuuguguaguagaaa

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).