Stem-loop sequence osa-MIR2863c

AccessionMI0018060 (change log)
DescriptionOryza sativa miR2863c stem-loop
Gene family MIPF0000925; MIR2863
Literature search

4 open access papers mention osa-MIR2863c
(4 sentences)

Stem-loop 
   -       uc   a    c        a      a                  u  a 
5'  ggguauu  uug ccca uuuaguuc acuaaa ugaacuaaguuucacuuu ag g
    |||||||  ||| |||| |||||||| |||||| |||||||||||||||||| || a
3'  cccauaa  aac gggu agaucagg ugauuu acuugauuuaaagugaaa uc g
   a       ga   c    a        a      -                  -  u
Get sequence
Deep sequencing
230 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 29869493-29869606 [+]
intergenic
Database links

Mature sequence osa-miR2863c

Accession MIMAT0021093
Sequence

82 -  

uuaguaggacuagaaugggccaaa

 - 105

Get sequence
Deep sequencing229 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).