Stem-loop sequence osa-MIR2275d

AccessionMI0019043 (change log)
DescriptionOryza sativa miR2275d stem-loop
Gene family MIPF0000797; MIR2275
Literature search

14 open access papers mention osa-MIR2275d
(82 sentences)

Stem-loop 
   uugu       ------     a      -               acugauu     uu         a    
5'     ucaggca      cugga gugaga auuggaggaaaacaa       gcugg  guuguuugc aca 
       |||||||      ||||| |||||| |||||||||||||||       |||||  ||||||||| || g
3'     aguucgu      gacuu cacucu uaaccucuuuuuguu       cgacu  uaacaaacg ugu 
   ----       uaguug     c      a               -------     ug         g
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 3736806-3736932 [-]
intergenic
Database links

Mature sequence osa-miR2275d

Accession MIMAT0022158
Sequence

86 -  

cuuguuuuucuccaauaucuca

 - 107

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21679406 "Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa" Wei LQ, Yan LF, Wang T Genome Biol. 12:R53(2011).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).