Stem-loop sequence osa-MIR1858b

AccessionMI0008241 (change log)
DescriptionOryza sativa miR1858b stem-loop
Gene family MIPF0000650; MIR1858
Literature search

1 open access papers mention osa-MIR1858b
(1 sentences)

Stem-loop
   uc     a           aaa                                gag      a           a           a     -  cg 
5'   ccguc ucgcugccggc   ggggggggugccgcaacaaggagaggaggacg   uggggc aguggagcguc aaggggauguc ucgcu gc  a
     ||||| |||||||||||   ||||||||||||||||||||||||||||||||   |||||| ||||||||||| ||||||||||| ||||| ||  a
3'   gguag agcgacggucg   uuccccccacggcguuguuccucuccuccugu   accccg ucaccucguag uuccccuacag gguga cg  u
   -c     c           --c                                aua      c           c           -     u  uc 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 13194040-13194233 [+]
intergenic
Database links

Mature sequence osa-miR1858b

Accession MIMAT0007787
Sequence

43 - 

gagaggaggacggaguggggc

 - 63

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).