![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR172a |
|||||
Accession | MI0001139 (change log) | ||||
Description | Oryza sativa miR172a stem-loop | ||||
Gene family | MIPF0000035; MIR172 | ||||
Literature search |
![]()
78 open access papers mention osa-MIR172a | ||||
Stem-loop |
g gc ug a u --------------- auauau 5' uguuugcgg g gcaucaucaagauuc ca cca ugc c ||||||||| | ||||||||||||||| || ||| ||| 3' acagacgcc c cguaguaguucuaag gu ggu acg a a ua gu a c uuagccuacauauac cagaac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR172 family [1]. It is predicted to target mRNAs coding for APETALA2-like transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR172a |
|
Accession | MIMAT0001069 |
Sequence |
79 - agaaucuugaugaugcugcau - 99 |
Deep sequencing | 5292 reads, 2 experiments |
Evidence | by similarity; MI0000215 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|