Stem-loop sequence osa-MIR169g

Accession

MI0001122 (change log)

Description

Oryza sativa miR169g stem-loop

Gene family

MIPF0000012; MIR169_1

Literature search

62 open access papers mention osa-MIR169g
(331 sentences)

Stem-loop

   cu   u  --   -         u    u       -gu    u       g u  -  u     ga 
5'   gcc cu  ggu agccaagga gacu gccuauu   gcuc ucugaau a gc ag gccau  u
     ||| ||  ||| ||||||||| |||| |||||||   |||| ||||||| | || || |||||  c
3'   cgg ga  ccg ucgguuccu cuga cggauag   cgag agacuug u cg uc cggug  a
   --   u  gu   a         -    -       agc    u       g -  g  -     ug 

Deep sequencing

6026 reads, 3.95e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

• Coordinates (MSU7): Chr4: 19420077-19420202 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001122

Mature sequence osa-miR169g

• Accession: MIMAT0001052
• Sequence: 11 - uagccaaggaugacuugccua - 31
• Deep sequencing: 5696 reads, 2 experiments
• Evidence: by similarity; MI0000212
• Database links:
  • RNAcentral:URS00002250DC_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).