Stem-loop sequence osa-MIR169e

Accession

MI0001120 (change log)

Description

Oryza sativa miR169e stem-loop

Gene family

MIPF0000012; MIR169_1

Literature search

63 open access papers mention osa-MIR169e
(312 sentences)

Stem-loop

   gcu      ---           ---           -  -  gu   --ugu    -  --     c    a 
5'    gguugu   guagccaagga   ugacuugccgg cc ug  uug     ucau ca  gcaau cagc u
      ||||||   |||||||||||   ||||||||||| || ||  |||     |||| ||  ||||| ||||  
3'    ccaaca   caucgguuucu   auugaacggcc gg ac  agc     agug gu  cguua gucg a
   ---      uua           uuu           a  u  gu   uagcu    u  gc     u    u 

Deep sequencing

5666 reads, 3.65e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

• Coordinates (MSU7): Chr2: 31205866-31205997 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001120

Mature sequence osa-miR169e

• Accession: MIMAT0001050
• Sequence: 11 - uagccaaggaugacuugccgg - 31
• Deep sequencing: 5664 reads, 2 experiments
• Evidence: by similarity; MI0000212
• Database links:
  • RNAcentral:URS00000028A7_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).