Stem-loop sequence osa-MIR169b

Accession

MI0001117 (change log)

Description

Oryza sativa miR169b stem-loop

Gene family

MIPF0000037; MIR169_2

Literature search

60 open access papers mention osa-MIR169b
(318 sentences)

Stem-loop

        ga   c         ug         uac    au     uu  aagguacuauaugu 
5' gaacg  aug agccaagga  acuugccgg   gugu  gcaug  uc              g
   |||||  ||| |||||||||  |||||||||   ||||  |||||  ||               
3' cuugu  ugc ucgguuccu  ugaacggcc   uaca  cguac  ag              c
        uc   a         gu         uuu    gu     cu  auuuugucaacccc 

Deep sequencing

5784 reads, 3.7e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

• Coordinates (MSU7): Chr6: 27295908-27296035 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001117

Mature sequence osa-miR169b

• Accession: MIMAT0001047
• Sequence: 11 - cagccaaggaugacuugccgg - 31
• Deep sequencing: 5757 reads, 2 experiments
• Evidence: by similarity; MI0000212
• Database links:
  • RNAcentral:URS00000036DB_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).