Stem-loop sequence ath-MIR161

Accession

MI0000193 (change log)

Description

Arabidopsis thaliana miR161 stem-loop

Gene family

MIPF0000455; MIR161

Literature search

12 open access papers mention ath-MIR161
(41 sentences)

Stem-loop

   u    ga    gg      ac   uuuau     c   c      u            c         cc    uuuu     ----        
5'  gcuu  ucuc  uuuuug  cag     ugcgu gau aaugca ugaaagugacua aucgggguu  gauu    uuguu    cuucaua 
    ||||  ||||  ||||||  |||     ||||| ||| |||||| |||||||||||| |||||||||  ||||    |||||    |||||| u
3'  cgaa  aggg  aaaaau  guu     acgua cua uuacgu acuuucacugau uggucccaa  cuaa    gacaa    gaaguag 
   a    -a    ag      --   ----u     a   a      c            u         --    ---u     aggc        

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

MIR161 is to target mRNAs coding for PPR repeat proteins [2].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr1: 17825685-17825857 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000079E1EC_3702
• miRBase Tracker:MI0000193

Mature sequence ath-miR161.2

• Accession: MIMAT0006779
• Sequence: 38 - ucaaugcauugaaagugacua - 58
• Evidence: experimental; cloned [3], PARE [6], Illumina [7]

Mature sequence ath-miR161.1

• Accession: MIMAT0000181
• Previous IDs: ath-miR161
• Sequence: 47 - ugaaagugacuacaucggggu - 67
• Evidence: experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [5], Illumina [7]

References

1. PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2. PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
6. PMID:18542052 "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends" German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ Nat Biotechnol. 26:941-946(2008).
7. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).