Stem-loop sequence hsa-mir-12133

AccessionMI0039735 (change log)
DescriptionHomo sapiens miR-12133 stem-loop
Stem-loop
     a                      a         auc 
5' ga guguacuuuuuaauggugccaa cagcaguug   u
   || |||||||||||||||||||||| |||||||||    
3' cu uacaugaaaaauuaccacgguu gucgucaau   a
     a                      c         aau 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 94543702-94543779 [+]
intergenic
Database links

Mature sequence hsa-miR-12133

Accession MIMAT0049027
Sequence

53 - 

cuuggcaccauuaaaaaguaca

 - 74

Get sequence
Deep sequencing67 reads, 30 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).