Stem-loop sequence hsa-mir-12132

AccessionMI0039734 (change log)
DescriptionHomo sapiens miR-12132 stem-loop
Stem-loop
   --u    a                                   a     au 
5'    uaac ucuuuuccaucauaauucucauaguaauaauagua uguua  a
      |||| ||||||||||||||||||||||||||||||||||| |||||   
3'    auug agaaaagguaguauuaagagugucauuauuauugu auaau  u
   auu    a                                   a     aa 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 61846075-61846176 [+]
intergenic
Database links

Mature sequence hsa-miR-12132

Accession MIMAT0049026
Sequence

66 - 

uauuacugugagaauuaugaug

 - 87

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).