Stem-loop sequence hsa-mir-12131

AccessionMI0039733 (change log)
DescriptionHomo sapiens miR-12131 stem-loop
Stem-loop
   ---uccc                                 u     -u   u 
5'        ugcccuuuauuugggaguacaccucuccaaaua acagu  aac g
          ||||||||||||||||||||||||||||||||| |||||  |||  
3'        acgggaaauaaacccucauguggagagguuuau uguca  uug a
   cucccau                                 u     uu   u 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 151102675-151102776 [+]
intergenic
Database links

Mature sequence hsa-miR-12131

Accession MIMAT0049025
Sequence

65 - 

uuuggagagguguacuccca

 - 84

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).