Stem-loop sequence hsa-mir-12129

AccessionMI0039731 (change log)
DescriptionHomo sapiens miR-12129 stem-loop
Stem-loop
   -a    a                        acaaaa 
5'   cagu ucuggcccaguucaguacaucccc      u
     |||| ||||||||||||||||||||||||      g
3'   guca agacugggucaagucauguagggg      u
   ga    c                        gaucau 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 153335462-153335537 [+]
intergenic
Database links

Mature sequence hsa-miR-12129

Accession MIMAT0049023
Sequence

49 - 

gauguacugaacugggucagac

 - 70

Get sequence
Deep sequencing14 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).