Stem-loop sequence hsa-mir-12128

AccessionMI0039730 (change log)
DescriptionHomo sapiens miR-12128 stem-loop
Stem-loop
      cuc      a  a -----       g -    u   -----   ga   g 
5' cca   ccgguc cc c     gcgccgu c uggg gcu     ggg  ugu a
   |||   |||||| || |     ||||||| | |||| |||     |||  ||| c
3' ggu   ggccag gg g     cgcggua g acuu cgg     ccc  aca g
      cuc      a  a aagua       g g    u   agaca   aa   a 
Get sequence
Deep sequencing
11 reads, 55.6 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 85207796-85207895 [+]
intergenic
Database links

Mature sequence hsa-miR-12128

Accession MIMAT0049022
Sequence

65 - 

uucagggauggcgcaugaagaggaga

 - 90

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).