Stem-loop sequence hsa-mir-12127

AccessionMI0039729 (change log)
DescriptionHomo sapiens miR-12127 stem-loop
Stem-loop
   ucaag    -ga   cu      --  ------    g    u    u    -a  u 
5'      uccu   gcu  gcucug  cc      gccu cugg gccu guaa  gg a
        ||||   |||  ||||||  ||      |||| |||| |||| ||||  ||  
3'      agga   uga  ugggac  gg      ugga gauc cgga cauu  uc u
   --cag    gag   au      cu  uaaucu    -    c    -    gc  a 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 10280351-10280452 [+]
intergenic
Database links

Mature sequence hsa-miR-12127

Accession MIMAT0049021
Sequence

65 - 

uagagguucuaaugguccaggguua

 - 89

Get sequence
Deep sequencing19 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).