Stem-loop sequence hsa-mir-12126

AccessionMI0039728 (change log)
DescriptionHomo sapiens miR-12126 stem-loop
Stem-loop
   ---aggaa      -u   c   -    -   ag    ---      -a  a  g 
5'         ggggac  ggg agg cugg ccu  gguu   gagcuc  gg ag a
           ||||||  ||| ||| |||| |||  ||||   ||||||  || ||  
3'         ucucug  cuu ucc gacc ggg  ucag   uuuggg  cc uc u
   cuuuaaca      uu   u   a    a   gu    aac      ga  g  u 
Get sequence
Deep sequencing
20 reads, 18.8 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 130241387-130241488 [+]
intergenic
Database links

Mature sequence hsa-miR-12126

Accession MIMAT0049020
Sequence

65 - 

gacuuggggaccagaccuuuucuu

 - 88

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).