![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-12126 |
|||||
Accession | MI0039728 (change log) | ||||
Description | Homo sapiens miR-12126 stem-loop | ||||
Stem-loop |
---aggaa -u c - - ag --- -a a g 5' ggggac ggg agg cugg ccu gguu gagcuc gg ag a |||||| ||| ||| |||| ||| |||| |||||| || || 3' ucucug cuu ucc gacc ggg ucag uuuggg cc uc u cuuuaaca uu u a a gu aac ga g u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-12126 |
|
Accession | MIMAT0049020 |
Sequence |
65 - gacuuggggaccagaccuuuucuu - 88 |
Deep sequencing | 4 reads, 3 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:28471449
"Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors"
Cell Death Dis. 8:e2759(2017).
|