Stem-loop sequence hsa-mir-12125

AccessionMI0039727 (change log)
DescriptionHomo sapiens miR-12125 stem-loop
Stem-loop
            ca                          uaga 
5' caguuaauu  gaguugcuuaugucaggugagagggg    c
   |||||||||  ||||||||||||||||||||||||||    a
3' gucaauuaa  cuuaacgaauacgguccacucucucu    c
            ca                          uaac 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 168165845-168165929 [+]
intergenic
Database links

Mature sequence hsa-miR-12125

Accession MIMAT0049019
Sequence

51 - 

ucucucaccuggcauaagcaau

 - 72

Get sequence
Deep sequencing55 reads, 29 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).