Stem-loop sequence hsa-mir-548ae-2

Accession

MI0016780 (change log)

Symbol

HGNC:MIR548AE2

Description

Homo sapiens miR-548ae-2 stem-loop

Gene family

MIPF0000317; mir-548

Literature search

56 open access papers mention hsa-mir-548ae-2
(170 sentences)

Stem-loop

   u   ca          ug            ua 
5'  gug  aaaguaauug  guuuuugucauu  a
    |||  ||||||||||  ||||||||||||  a
3'  cac  uuucauuaac  caaaaacgguaa  a
   c   ac          gu            ug 

Deep sequencing

15175 reads, 10.4 reads per million, 154 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr5: 58530043-58530109 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000367940 ; PDE4D-001; intron 1

  OTTHUMT00000368105 ; PDE4D-014; intron 1

  OTTHUMT00000368103 ; PDE4D-012; intron 1

  OTTHUMT00000368107 ; PDE4D-016; intron 1

  OTTHUMT00000368106 ; PDE4D-015; intron 1

  OTTHUMT00000368108 ; PDE4D-017; intron 1

  OTTHUMT00000368104 ; PDE4D-013; intron 1

  OTTHUMT00000368093 ; PDE4D-002; intron 1

  OTTHUMT00000368102 ; PDE4D-011; intron 1

  OTTHUMT00000368800 ; PDE4D-025; intron 2

  OTTHUMT00000368094 ; PDE4D-003; intron 3

  ENST00000340635 ; PDE4D-001; intron 1

  ENST00000360047 ; PDE4D-014; intron 1

  ENST00000507116 ; PDE4D-012; intron 1

  ENST00000503258 ; PDE4D-016; intron 1

  ENST00000405755 ; PDE4D-015; intron 1

  ENST00000505453 ; PDE4D-017; intron 1

  ENST00000309641 ; PDE4D-013; intron 1

  ENST00000405053 ; PDE4D-002; intron 1

  ENST00000502575 ; PDE4D-011; intron 1

  ENST00000514231 ; PDE4D-025; intron 2

  ENST00000546160 ; PDE4D-201; intron 2

  ENST00000502484 ; PDE4D-003; intron 3

Database links

• EntrezGene:MIR548AE2
• HGNC:MIR548AE2
• RNAcentral:URS000075D567_9606
• miRBase Tracker:MI0016780

Mature sequence hsa-miR-548ae-5p

• Accession: MIMAT0032115
• Sequence: 6 - aaaaguaauugugguuuuug - 25
• Deep sequencing: 11183 reads, 153 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000077CDCE_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-548ae-5p
  • miRDB:hsa-miR-548ae-5p

Mature sequence hsa-miR-548ae-3p

• Accession: MIMAT0018954
• Previous IDs: hsa-miR-548ae
• Sequence: 43 - caaaaacugcaauuacuuuca - 63
• Deep sequencing: 7942 reads, 103 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-548ae-3p
  • miRDB:hsa-miR-548ae-3p

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).