Stem-loop sequence hsa-mir-181b-2

Accession

MI0000683 (change log)

Symbol

HGNC:MIR181B2

Description

Homo sapiens miR-181b-2 stem-loop

Gene family

MIPF0000007; mir-181

Literature search

362 open access papers mention hsa-mir-181b-2
(1567 sentences)

Stem-loop

   cuga   -     cucaa         cu           u  gu 
5'     ugg cugca     cauucauug  gucgguggguu ga  c
       ||| |||||     |||||||||  ||||||||||| ||  u
3'     acc ggcgu     guaaguaac  uagucacucaa cu  g
   acaa   a     caaac         --           -  aa 

Deep sequencing

700041 reads, 894 reads per million, 157 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MI0000270) is found on chromosome 1 [1], and mir-181b-2 (MI0000683) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 124693710-124693798 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000053903 ; C9orf148-001; intron 1

  OTTHUMT00000106443 ; TTLL11-003; intron 5

  OTTHUMT00000053906 ; TTLL11-001; intron 6

  ENST00000411790 ; TTLL11-IT1-001; intron 1

  ENST00000474723 ; TTLL11-003; intron 5

  ENST00000373778 ; TTLL11-001; intron 6

  ENST00000321582 ; TTLL11-201; intron 6

Clustered miRNAs

< 10kb from hsa-mir-181b-2

• hsa-mir-181a-2: chr9: 124692442-124692551 [+]
• hsa-mir-181b-2: chr9: 124693710-124693798 [+]

Database links

• EntrezGene:MIR181B2
• HGNC:MIR181B2
• RNAcentral:URS000075BF74_9606
• Rfam:mir-181
• miRBase Tracker:MI0000683

Mature sequence hsa-miR-181b-5p

• Accession: MIMAT0000257
• Previous IDs: hsa-miR-181b
• Sequence: 16 - aacauucauugcugucggugggu - 38
• Deep sequencing: 1387103 reads, 157 experiments
• Evidence: experimental; cloned [3-5]
• Database links:
  • RNAcentral:URS0000605E00_9606
• Predicted targets:
  • TargetMiner:hsa-miR-181b-5p
  • TargetScanVert:hsa-miR-181b-5p
  • miRDB:hsa-miR-181b-5p
  • microrna.org:hsa-miR-181b-5p

Mature sequence hsa-miR-181b-2-3p

• Accession: MIMAT0031893
• Sequence: 54 - cucacugaucaaugaaugca - 73
• Deep sequencing: 1909 reads, 114 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000764165_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-181b-2-3p
  • miRDB:hsa-miR-181b-2-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).