Stem-loop sequence mmu-mir-8108

AccessionMI0026039 (change log)
Symbol MGI:Mir8108
DescriptionMus musculus miR-8108 stem-loop
Stem-loop 
   --------acuca     -gug    c  cauu    c          u    --ca   c 
5'              ugcau    uucu ua    cugc gcuuuucccc gagg    uau c
                |||||    |||| ||    |||| |||||||||| ||||    |||  
3'              augua    aaga au    gaug cgaggagggg cucc    aua a
   guuuuauucucgg     aaga    c  ---u    -          u    caga   g
Get sequence
Deep sequencing
300 reads, 1.85 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 25159125-25159233 [-]
sense
ENSMUST00000084512 ; Tacc1-202; 3'UTR (exon 11)
ENSMUST00000084030 ; Tacc1-201; 3'UTR (exon 13)
Database links

Mature sequence mmu-miR-8108

Accession MIMAT0031413
Sequence

63 -  

ucuggggaggagcguaguuaca

 - 84

Get sequence
Deep sequencing264 reads, 42 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23185045 "Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2" Polikepahad S, Corry DB Nucleic Acids Res. 41:1164-1177(2013).