Stem-loop sequence mmu-mir-8103

AccessionMI0026033 (change log)
Symbol MGI:Mir8103
DescriptionMus musculus miR-8103 stem-loop
Stem-loop 
   gggga   -----ag       aca   a                 cggagu      a 
5'      gcc       ucugcag   aga ggggagcagggagcagg      ggaagg g
        |||       |||||||   ||| |||||||||||||||||      |||||| u
3'      cgg       ggacguc   ucu ccucuugucucuugucc      ucuucc u
   --gua   gaaacga       -ag   c                 ------      a
Get sequence
Deep sequencing
382 reads, 1.69 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 97063768-97063874 [+]
sense
OTTMUST00000004469 ; Osbpl7-001; intron 16
ENSMUST00000090020 ; Osbpl7-001; intron 16
ENSMUST00000168565 ; Osbpl7-201; intron 17
Database links

Mature sequence mmu-miR-8103

Accession MIMAT0031407
Sequence

62 -  

ucuccuguucucuguucuccc

 - 82

Get sequence
Deep sequencing368 reads, 57 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23185045 "Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2" Polikepahad S, Corry DB Nucleic Acids Res. 41:1164-1177(2013).