Stem-loop sequence mmu-mir-8102

AccessionMI0026032 (change log)
Symbol MGI:Mir8102
DescriptionMus musculus miR-8102 stem-loop
Stem-loop 
   gguacc    g  --c     c    - ca    -  ccg    c  c     ---    g  c     --  aa 
5'       gccc uc   ccggg gcuu g  gcug cc   ccca uc uccuc   uccc gc ugaag  gg  c
         |||| ||   ||||| |||| |  |||| ||   |||| || |||||   |||| || |||||  ||  c
3'       cggg ag   ggcuc cgga c  cgac gg   gggu ag aggag   gggg cg acuuc  cc  c
   -----u    a  aac     a    g uc    a  uag    c  a     caa    g  c     gg  ga
Get sequence
Deep sequencing
78 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 97744897-97745035 [+]
intergenic
Database links

Mature sequence mmu-miR-8102

Accession MIMAT0031406
Sequence

78 -  

ucacgcgggggaacgaggaaga

 - 99

Get sequence
Deep sequencing54 reads, 21 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23185045 "Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2" Polikepahad S, Corry DB Nucleic Acids Res. 41:1164-1177(2013).