Stem-loop sequence mmu-mir-8095

AccessionMI0026022 (change log)
Symbol MGI:Mir8095
DescriptionMus musculus miR-8095 stem-loop
Stem-loop 
   cguaa      ---u    a   -----u      --a  a aa  --a   auu    u    -   -   ug 
5'      uggcug    gggc ugc      gagcug   gg g  ga   agg   cugc gucu guc cca  g
        ||||||    |||| |||      ||||||   || |  ||   |||   |||| |||| ||| |||  u
3'      acuggu    cccg aug      cuugac   cc c  cu   ucc   gaug uaga uag ggu  u
   ---gg      uggu    -   uuucau      aga  - ca  gug   --g    -    g   a   ua
Get sequence
Deep sequencing
33 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 22532056-22532184 [-]
sense
OTTMUST00000061253 ; Dgkg-004; intron 19
OTTMUST00000061251 ; Dgkg-001; intron 20
ENSMUST00000023578 ; Dgkg-004; intron 19
ENSMUST00000089925 ; Dgkg-001; intron 20
Database links

Mature sequence mmu-miR-8095

Accession MIMAT0031396
Sequence

36 -  

aaaggauucugcugucuguccc

 - 57

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23185045 "Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2" Polikepahad S, Corry DB Nucleic Acids Res. 41:1164-1177(2013).