Stem-loop sequence hsa-mir-8066

AccessionMI0025902 (change log)
Symbol HGNC:MIR8066
DescriptionHomo sapiens miR-8066 stem-loop
Stem-loop 
   cauc     -     u  ugu   a        ----   c 
5'     uugcu uacau cc   gga cauauugu    ugc u
       ||||| ||||| ||   ||| ||||||||    |||  
3'     aacgg augua gg   ucu guguaaca    acg c
   ucua     g     -  uuu   a        uugu   u
Get sequence
Deep sequencing
13 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 101240795-101240872 [-]
intergenic
Database links

Mature sequence hsa-miR-8066

Accession MIMAT0030993
Sequence

48 -  

caaugugaucuuuuggaugua

 - 68

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).