Stem-loop sequence mmu-mir-6715

AccessionMI0025026 (change log)
Symbol MGI:Mir6715
DescriptionMus musculus miR-6715 stem-loop
Gene family MIPF0001708; mir-6715
Literature search

1 open access papers mention mmu-mir-6715
(30 sentences)

Stem-loop
   --        - aca      a   u   g 
5'   acaggcac c   gguuug gca uuu a
     |||||||| |   |||||| ||| |||  
3'   uguccgug g   ccaaac cgu aag u
   gg        c -ga      -   u   u 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 55192678-55192734 [+]
sense
OTTMUST00000070020 ; Tectb-002; exon 2
OTTMUST00000070024 ; Tectb-006; 3'UTR (exon 4)
OTTMUST00000070019 ; Tectb-001; intron 8
OTTMUST00000070022 ; Tectb-004; intron 9
ENSMUST00000148123 ; Tectb-002; exon 2
ENSMUST00000124545 ; Tectb-006; 3'UTR (exon 4)
ENSMUST00000025936 ; Tectb-001; intron 8
ENSMUST00000120936 ; Tectb-004; intron 9
Database links

Mature sequence mmu-miR-6715-5p

Accession MIMAT0029876
Sequence

1 - 

acaggcaccacagguuugagcau

 - 23

Get sequence
Deep sequencing30 reads, 13 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-6715-3p

Accession MIMAT0029877
Sequence

37 - 

ccaaaccaggcgugccugugg

 - 57

Get sequence
Deep sequencing15 reads, 6 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1