Stem-loop sequence mmu-mir-7657

AccessionMI0024997 (change log)
Symbol MGI:Mir7657
DescriptionMus musculus miR-7657 stem-loop
Stem-loop
   -aau      --     u   u    uaa 
5'     aguugg  auagu agg aaaa   c
       ||||||  ||||| ||| ||||    
3'     ucaacc  uaucg ucc uuuu   a
   uggu      cu     u   u    cug 
Get sequence
Deep sequencing
96 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 122541625-122541681 [-]
sense
OTTMUST00000087183 ; Fnbp1l-001; 3'UTR (exon 14)
ENSMUST00000162409 ; Fnbp1l-001; 3'UTR (exon 14)
Database links

Mature sequence mmu-miR-7657-5p

Accession MIMAT0029820
Sequence

1 - 

aauaguuggauaguuagguaa

 - 21

Get sequence
Deep sequencing92 reads, 26 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7657-3p

Accession MIMAT0029821
Sequence

35 - 

uuccuugcuauucccaacuuggu

 - 57

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1