Stem-loop sequence mmu-mir-7118

AccessionMI0022969 (change log)
Symbol MGI:Mir7118
DescriptionMus musculus miR-7118 stem-loop
Literature search

1 open access papers mention mmu-mir-7118
(1 sentences)

Stem-loop
   ggguc   -   a    gg    ggaacaga 
5'      ugg gga ggcg  agag        a
        ||| ||| ||||  ||||        c
3'      acc ccu cugc  ucuc        a
   --gac   u   c    -a    aaucgaca 
Get sequence
Deep sequencing
44 reads, 24 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 89162848-89162908 [-]
sense
OTTMUST00000049692 ; Plxnb2-001; intron 13
ENSMUST00000060808 ; Plxnb2-201; intron 12
ENSMUST00000109331 ; Plxnb2-001; intron 13
Database links

Mature sequence mmu-miR-7118-5p

Accession MIMAT0028133
Sequence

6 - 

uggggaaggcgggagagggaac

 - 27

Get sequence
Deep sequencing21 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7118-3p

Accession MIMAT0028134
Sequence

39 - 

uaacucuacguccuccuccaca

 - 60

Get sequence
Deep sequencing21 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).