Stem-loop sequence mmu-mir-7082

AccessionMI0022932 (change log)
Symbol MGI:Mir7082
DescriptionMus musculus miR-7082 stem-loop
Stem-loop
   gaa  -u        gag      a   a    gcu -   aa   ug 
5'    gg  acgggcag   gagggg ggc cagg   g ggc  ccc  g
      ||  ||||||||   |||||| ||| ||||   | |||  |||  c
3'    cc  ugucuguc   uucccc ccg gucc   c ccg  ggg  u
   -ga  uc        --g      -   -    agu a   ga   uc 
Get sequence
Deep sequencing
59 reads, 300 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 21075497-21075588 [-]
sense
ENSMUST00000115487 ; Raver1-201; intron 12
Database links

Mature sequence mmu-miR-7082-5p

Accession MIMAT0028070
Sequence

6 - 

uacgggcaggaggaggggagg

 - 26

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7082-3p

Accession MIMAT0028071
Sequence

69 - 

gccccccuugcugucugucucc

 - 90

Get sequence
Deep sequencing42 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).