Stem-loop sequence mmu-mir-7080

AccessionMI0022930 (change log)
Symbol MGI:Mir7080
DescriptionMus musculus miR-7080 stem-loop
Stem-loop 
   --     -   u   --            --aua    
5'   guagg agc gga  gguggguuuggc     gcg 
     ||||| ||| |||  ||||||||||||     || c
3'   caucc uug ccu  ccacucggaccg     cgu 
   ga     c   -   cc            ggcua
Get sequence
Deep sequencing
2006 reads, 6.9 reads per million, 29 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 123130106-123130172 [+]
sense
OTTMUST00000064647 ; AC114005.5-001; intron 1
OTTMUST00000068238 ; Cpne7-004; exon 3
OTTMUST00000068236 ; Cpne7-002; intron 9
OTTMUST00000068237 ; Cpne7-003; intron 11
OTTMUST00000068235 ; Cpne7-001; intron 12
ENSMUST00000127664 ; Gm20388-001; intron 1
ENSMUST00000127431 ; Cpne7-004; exon 3
ENSMUST00000131659 ; Cpne7-002; intron 9
ENSMUST00000134235 ; Cpne7-003; intron 11
ENSMUST00000037900 ; Cpne7-001; intron 12
Database links

Mature sequence mmu-miR-7080-5p

Accession MIMAT0028066
Sequence

1 -  

guaggagcuggagguggguuugg

 - 23

Get sequence
Deep sequencing1891 reads, 26 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7080-3p

Accession MIMAT0028067
Sequence

42 -  

caggcucaccccuccguucccu

 - 63

Get sequence
Deep sequencing113 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).