Stem-loop sequence mmu-mir-7078

AccessionMI0022928 (change log)
Symbol MGI:Mir7078
DescriptionMus musculus miR-7078 stem-loop
Stem-loop
   caggg                c c  g     a 
5'      ugugggugguaggaga g ug cuggu u
        |||||||||||||||| | || ||||| u
3'      acaccuacuauuuuuu c au gacca u
   ----g                u -  g     g 
Get sequence
Deep sequencing
151 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 117459265-117459328 [+]
sense
ENSMUST00000095172 ; Cmip-201; intron 20
ENSMUST00000166750 ; Cmip-202; intron 20
Clustered miRNAs
< 10kb from mmu-mir-7078
mmu-mir-7077chr8: 117453023-117453079 [+]
mmu-mir-7078chr8: 117459265-117459328 [+]
Database links

Mature sequence mmu-miR-7078-5p

Accession MIMAT0028062
Sequence

6 - 

ugugggugguaggagacgcu

 - 25

Get sequence
Deep sequencing147 reads, 37 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7078-3p

Accession MIMAT0028063
Sequence

44 - 

uacuuuuuuuaucauccacag

 - 64

Get sequence
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).