Stem-loop sequence mmu-mir-7073

AccessionMI0022923 (change log)
Symbol MGI:Mir7073
DescriptionMus musculus miR-7073 stem-loop
Stem-loop
   cuuucug     auu     a    g c   a 
5'        gggga   gaaag cuau a uua c
          |||||   ||||| |||| | ||| a
3'        ccccu   uuuuc gaua u aau a
   --gacaa     -cc     c    g c   u 
Get sequence
Deep sequencing
688 reads, 0 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 95753151-95753214 [-]
sense
ENSMUST00000098473 ; Cnot1-202; intron 19
ENSMUST00000068452 ; Cnot1-201; intron 19
Database links

Mature sequence mmu-miR-7073-5p

Accession MIMAT0028052
Sequence

6 - 

ugggggaauugaaagacuauga

 - 27

Get sequence
Deep sequencing684 reads, 74 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7073-3p

Accession MIMAT0028053
Sequence

43 - 

auagccuuuuccuccccaacag

 - 64

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).