Stem-loop sequence mmu-mir-7069

AccessionMI0022919 (change log)
Symbol MGI:Mir7069
DescriptionMus musculus miR-7069 stem-loop
Stem-loop
   aguguu      cc   g      aca    g 
5'       uggggg  ugg agggug   cuga g
         ||||||  ||| ||||||   |||| u
3'       aucccc  acc ucccgu   gacu c
   ---gac      -a   g      -cc    a 
Get sequence
Deep sequencing
89 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 84867947-84868008 [+]
sense
OTTMUST00000052999 ; Farsa-006; intron 2
OTTMUST00000052998 ; Farsa-005; intron 9
OTTMUST00000052994 ; Farsa-001; intron 10
OTTMUST00000052995 ; Farsa-002; intron 10
OTTMUST00000052996 ; Farsa-003; intron 10
ENSMUST00000141480 ; Farsa-006; intron 2
ENSMUST00000129595 ; Farsa-005; intron 9
ENSMUST00000003906 ; Farsa-001; intron 10
ENSMUST00000109754 ; Farsa-002; intron 10
ENSMUST00000156970 ; Farsa-003; intron 10
Database links

Mature sequence mmu-miR-7069-5p

Accession MIMAT0028044
Sequence

6 - 

uugggggccugggagggugacac

 - 28

Get sequence
Deep sequencing52 reads, 28 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7069-3p

Accession MIMAT0028045
Sequence

41 - 

ccugcccugccaaccccuaca

 - 61

Get sequence
Deep sequencing37 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).