Stem-loop sequence mmu-mir-6769b

AccessionMI0022917 (change log)
Symbol MGI:Mir6769b
DescriptionMus musculus miR-6769b stem-loop
Stem-loop
   ugcuccu      -         -    a  u 
5'        gguggg uggggaaga gccu gu c
          |||||| ||||||||| |||| ||  
3'        ccaccc gucccuucu cgga ua a
   ----gac      u         a    c  c 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 71631047-71631106 [-]
sense
OTTMUST00000104357 ; Unc13a-001; intron 41
OTTMUST00000104365 ; Unc13a-002; intron 42
ENSMUST00000030170 ; Unc13a-001; intron 41
ENSMUST00000177517 ; Unc13a-002; intron 42
Database links

Mature sequence mmu-miR-6769b-5p

Accession MIMAT0028040
Sequence

5 - 

ccugguggguggggaagagc

 - 24

Get sequence
Deep sequencing19 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6769b-3p

Accession MIMAT0028041
Sequence

40 - 

caucuucccugucccacccag

 - 60

Get sequence
Deep sequencing42 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).