Stem-loop sequence mmu-mir-7061

AccessionMI0022910 (change log)
Symbol MGI:Mir7061
DescriptionMus musculus miR-7061 stem-loop
Stem-loop
   gaauuuau            u   -   g  agaa 
5'         ggaaauaggagg gau uuu ag    a
           |||||||||||| ||| ||| ||     
3'         ccuuuauuuucc cua aaa uc    g
   --gauuuu            -   u   g  aguu 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 130908268-130908335 [+]
sense
OTTMUST00000072274 ; Plekha1-012; intron 1
OTTMUST00000072273 ; Plekha1-011; intron 2
OTTMUST00000072272 ; Plekha1-010; intron 3
OTTMUST00000072271 ; Plekha1-009; intron 5
OTTMUST00000072265 ; Plekha1-003; intron 8
OTTMUST00000072266 ; Plekha1-004; intron 9
OTTMUST00000072264 ; Plekha1-002; intron 10
OTTMUST00000072263 ; Plekha1-001; intron 10
ENSMUST00000135359 ; Plekha1-012; intron 1
ENSMUST00000126355 ; Plekha1-011; intron 2
ENSMUST00000146111 ; Plekha1-010; intron 3
ENSMUST00000136963 ; Plekha1-009; intron 5
ENSMUST00000048180 ; Plekha1-003; intron 8
ENSMUST00000151119 ; Plekha1-004; intron 9
ENSMUST00000120441 ; Plekha1-002; intron 10
ENSMUST00000075181 ; Plekha1-001; intron 10
antisense
OTTMUST00000094172 ; Fgfr2-007; intron 2
ENSMUST00000124096 ; Fgfr2-007; intron 2
Database links

Mature sequence mmu-miR-7061-5p

Accession MIMAT0028026
Sequence

6 - 

uauggaaauaggaggugauuuu

 - 27

Get sequence
Deep sequencing66 reads, 37 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7061-3p

Accession MIMAT0028027
Sequence

47 - 

uaucccuuuuauuuccuuuuag

 - 68

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).