Stem-loop sequence mmu-mir-7055

AccessionMI0022904 (change log)
Symbol MGI:Mir7055
DescriptionMus musculus miR-7055 stem-loop
Stem-loop
   uca     u    u    ug  a uu  ua 
5'    guggg uauc gagu  gg c  gc  u
      ||||| |||| ||||  || |  ||   
3'    caccc auag uuca  uc g  ug  g
   gac     c    u    --  - uu  ua 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 45173303-45173361 [+]
sense
ENSMUST00000085374 ; Slc17a7-201; intron 10
Database links

Mature sequence mmu-miR-7055-5p

Accession MIMAT0028014
Sequence

1 - 

ucaguggguuaucugaguugg

 - 21

Get sequence
Deep sequencing26 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7055-3p

Accession MIMAT0028015
Sequence

37 - 

uugcuacuuugauaccccaccag

 - 59

Get sequence
Deep sequencing13 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).