Stem-loop sequence mmu-mir-7053

AccessionMI0022902 (change log)
Symbol MGI:Mir7053
DescriptionMus musculus miR-7053 stem-loop
Stem-loop 
   ggag        a  c    u  u    a       agu 
5'     cuggggaa gg aggc ac gggg gcugggu   u
       |||||||| || |||| || |||| |||||||   c
3'     gaccccuu cc ucug ug ccuc cgacccg   g
   ----        -  -    -  u    -       aag
Get sequence
Deep sequencing
58 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 44538106-44538178 [-]
sense
OTTMUST00000071908 ; Pold1-006; intron 1
OTTMUST00000071903 ; Pold1-001; intron 15
OTTMUST00000071904 ; Pold1-002; intron 15
OTTMUST00000071905 ; Pold1-003; intron 15
ENSMUST00000132268 ; Pold1-006; intron 1
ENSMUST00000049343 ; Pold1-001; intron 15
ENSMUST00000138746 ; Pold1-002; intron 15
ENSMUST00000151793 ; Pold1-003; intron 15
Database links

Mature sequence mmu-miR-7053-5p

Accession MIMAT0028010
Sequence

6 -  

uggggaaaggcaggcuacugg

 - 26

Get sequence
Deep sequencing44 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7053-3p

Accession MIMAT0028011
Sequence

53 -  

cuccugugucuccuuccccag

 - 73

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).