Stem-loop sequence mmu-mir-7016

AccessionMI0022865 (change log)
Symbol MGI:Mir7016
DescriptionMus musculus miR-7016 stem-loop
Stem-loop
   cgacuca       g  c   a     c  cuau  a au 
5'        gggaggg ag gag guagg ca    gg c  g
          ||||||| || ||| ||||| ||    || |  c
3'        cccucuc uc cuc cgucc gu    cc g  u
   ----gac       g  -   -     a  ----  - ag 
Get sequence
Deep sequencing
72 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 129684500-129684571 [-]
sense
OTTMUST00000021763 ; Tmem39b-001; intron 6
OTTMUST00000021764 ; Tmem39b-002; intron 7
ENSMUST00000102588 ; Tmem39b-001; intron 6
ENSMUST00000125445 ; Tmem39b-002; intron 7
Database links

Mature sequence mmu-miR-7016-5p

Accession MIMAT0027936
Sequence

6 - 

cagggaggggagcgagaguag

 - 26

Get sequence
Deep sequencing59 reads, 26 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7016-3p

Accession MIMAT0027937
Sequence

51 - 

accugccuccugcucuccccag

 - 72

Get sequence
Deep sequencing13 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).