Stem-loop sequence mmu-mir-7015

AccessionMI0022864 (change log)
Symbol MGI:Mir7015
DescriptionMus musculus miR-7015 stem-loop
Stem-loop
   ugcccucu      ua   u     uuccaug u 
5'         gugcag  ggc guggg       c g
           ||||||  ||| |||||       | a
3'         cacguc  cug cacuc       g c
   -----gau      uc   u     --uuuca u 
Get sequence
Deep sequencing
414 reads, 8 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 120973259-120973322 [-]
sense
OTTMUST00000020139 ; Smap2-002; intron 2
OTTMUST00000020138 ; Smap2-001; intron 7
ENSMUST00000151615 ; Smap2-002; intron 2
ENSMUST00000043200 ; Smap2-001; intron 7
Database links

Mature sequence mmu-miR-7015-5p

Accession MIMAT0027934
Sequence

6 - 

ucugugcaguaggcuguggguuc

 - 28

Get sequence
Deep sequencing209 reads, 46 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7015-3p

Accession MIMAT0027935
Sequence

44 - 

ucucacuguccucugcacuag

 - 64

Get sequence
Deep sequencing205 reads, 64 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).