Stem-loop sequence mmu-mir-7013

AccessionMI0022862 (change log)
Symbol MGI:Mir7013
DescriptionMus musculus miR-7013 stem-loop
Stem-loop
   uucgguau        --     -u   a     a au 
5'         gaagaggc  cagug  ugu gcuug g  c
           ||||||||  |||||  ||| ||||| |   
3'         cuucuccg  gucau  aca cgaau c  c
   ---gacuc        uu     uc   c     c ga 
Get sequence
Deep sequencing
96 reads, 6.67 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 95004168-95004239 [+]
sense
OTTMUST00000055674 ; Pi4kb-004; intron 1
OTTMUST00000092602 ; Pi4kb-007; intron 7
OTTMUST00000047058 ; Pi4kb-001; intron 8
OTTMUST00000047059 ; Pi4kb-002; intron 9
OTTMUST00000082653 ; Pi4kb-005; intron 9
ENSMUST00000133297 ; Pi4kb-004; intron 1
ENSMUST00000167008 ; Pi4kb-007; intron 7
ENSMUST00000072287 ; Pi4kb-001; intron 8
ENSMUST00000107251 ; Pi4kb-002; intron 9
ENSMUST00000125476 ; Pi4kb-005; intron 9
antisense
OTTMUST00000047056 ; AC087062.8-001; intron 1
OTTMUST00000047057 ; AC087062.8-002; intron 1
ENSMUST00000143287 ; Gm15265-002; intron 1
ENSMUST00000133494 ; Gm15265-001; intron 1
Database links

Mature sequence mmu-miR-7013-5p

Accession MIMAT0027930
Sequence

6 - 

uaugaagaggccaguguuguag

 - 27

Get sequence
Deep sequencing83 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7013-3p

Accession MIMAT0027931
Sequence

46 - 

ccacacuuacuguugccucuuccu

 - 69

Get sequence
Deep sequencing13 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).