Stem-loop sequence mmu-mir-7012

AccessionMI0022861 (change log)
Symbol MGI:Mir7012
DescriptionMus musculus miR-7012 stem-loop
Literature search

1 open access papers mention mmu-mir-7012
(2 sentences)

Stem-loop
   gacggaa           ---  -     acua  u 
5'        ggagaggaguu   gg caggg    gc a
          |||||||||||   || |||||    || u
3'        ccucuccucgg   cc guccu    cg g
   ----gac           ugu  a     ---a  a 
Get sequence
Deep sequencing
265 reads, 4.17 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 90270149-90270212 [+]
sense
OTTMUST00000083727 ; Dennd4b-006; intron 3
OTTMUST00000083707 ; Dennd4b-002; intron 5
OTTMUST00000083710 ; Dennd4b-005; intron 7
OTTMUST00000083706 ; Dennd4b-001; intron 7
ENSMUST00000151648 ; Dennd4b-006; intron 3
ENSMUST00000156358 ; Dennd4b-002; intron 5
ENSMUST00000129564 ; Dennd4b-005; intron 7
ENSMUST00000098914 ; Dennd4b-001; intron 7
Database links

Mature sequence mmu-miR-7012-5p

Accession MIMAT0027928
Sequence

6 - 

aaggagaggaguuggcagggacu

 - 28

Get sequence
Deep sequencing243 reads, 40 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7012-3p

Accession MIMAT0027929
Sequence

43 - 

ugaccuguggcuccucucccag

 - 64

Get sequence
Deep sequencing20 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).