Stem-loop sequence mmu-mir-6992

AccessionMI0022840 (change log)
Symbol MGI:Mir6992
DescriptionMus musculus miR-6992 stem-loop
Stem-loop
   auau    cu     g   uggcug    -   uu       u      u  u  uaaca 
5'     cugc  gugau guu      agug gaa  gguugug uggagg ua gg     g
       ||||  ||||| |||      |||| |||  ||||||| |||||| || ||     c
3'     gacg  uacua uag      ucac cuu  ccaacac auuucc gu cc     c
   ----    uu     g   ------    u   --       c      c  -  uuucu 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 8742971-8743079 [+]
sense
OTTMUST00000103608 ; Stx5a-010; exon 1
OTTMUST00000103614 ; Stx5a-015; intron 1
OTTMUST00000103603 ; Stx5a-005; intron 2
OTTMUST00000103605 ; Stx5a-007; intron 2
OTTMUST00000103610 ; Stx5a-002; intron 2
OTTMUST00000103612 ; Stx5a-003; intron 2
OTTMUST00000103613 ; Stx5a-014; intron 2
OTTMUST00000103560 ; Stx5a-001; intron 3
OTTMUST00000103606 ; Stx5a-006; intron 3
OTTMUST00000103607 ; Stx5a-004; intron 3
OTTMUST00000103611 ; Stx5a-013; intron 3
ENSMUST00000176093 ; Stx5a-010; exon 1
ENSMUST00000176009 ; Stx5a-015; intron 1
ENSMUST00000177322 ; Stx5a-005; intron 2
ENSMUST00000177373 ; Stx5a-007; intron 2
ENSMUST00000073430 ; Stx5a-002; intron 2
ENSMUST00000176013 ; Stx5a-003; intron 2
ENSMUST00000176260 ; Stx5a-014; intron 2
ENSMUST00000176381 ; Stx5a-001; intron 3
ENSMUST00000175872 ; Stx5a-006; intron 3
ENSMUST00000010254 ; Stx5a-004; intron 3
ENSMUST00000175901 ; Stx5a-013; intron 3
Database links

Mature sequence mmu-miR-6992-5p

Accession MIMAT0027886
Sequence

6 - 

ugccugugaugguuuggcugagu

 - 28

Get sequence
Deep sequencing25 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6992-3p

Accession MIMAT0027887
Sequence

88 - 

ucucacugaugaucauuugcag

 - 109

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).