Stem-loop sequence mmu-mir-6988

AccessionMI0022836 (change log)
Symbol MGI:Mir6988
DescriptionMus musculus miR-6988 stem-loop
Stem-loop
   au    g u     -  u    cc     ag 
5'   cugg g ggaga gc gagg  caggu  c
     |||| | ||||| || ||||  |||||   
3'   gacc u ccucu ug cucc  guccg  u
   --    g -     a  u    -a     ac 
Get sequence
Deep sequencing
404 reads, 1.37 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 6051334-6051392 [+]
sense
OTTMUST00000082237 ; Syvn1-003; intron 8
OTTMUST00000082238 ; Syvn1-004; intron 11
OTTMUST00000082235 ; Syvn1-001; intron 13
OTTMUST00000082239 ; Syvn1-005; intron 13
OTTMUST00000082236 ; Syvn1-002; intron 13
ENSMUST00000142101 ; Syvn1-003; intron 8
ENSMUST00000025723 ; Syvn1-004; intron 11
ENSMUST00000138532 ; Syvn1-001; intron 13
ENSMUST00000156550 ; Syvn1-005; intron 13
ENSMUST00000134667 ; Syvn1-002; intron 13
Database links

Mature sequence mmu-miR-6988-5p

Accession MIMAT0027878
Sequence

5 - 

gggguggagagcugaggccca

 - 25

Get sequence
Deep sequencing27 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6988-3p

Accession MIMAT0027879
Sequence

38 - 

ugaccucuguaucuccugccag

 - 59

Get sequence
Deep sequencing370 reads, 68 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).