Stem-loop sequence mmu-mir-6987

AccessionMI0022835 (change log)
Symbol MGI:Mir6987
DescriptionMus musculus miR-6987 stem-loop
Stem-loop
   aacag     -     u  -ca      ga    uaga 
5'      uggga caggg ga   ggguga  ccca    u
        ||||| ||||| ||   ||||||  ||||    c
3'      accuu guccc cu   cccacu  gggu    a
   ----g     c     u  uua      uc    cgag 
Get sequence
Deep sequencing
137 reads, 15.6 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 5679004-5679076 [-]
sense
OTTMUST00000083272 ; Pcnxl3-010; intron 2
OTTMUST00000083270 ; Pcnxl3-008; intron 6
OTTMUST00000083267 ; Pcnxl3-005; intron 9
OTTMUST00000083266 ; Pcnxl3-004; intron 13
OTTMUST00000083263 ; Pcnxl3-001; intron 15
ENSMUST00000137313 ; Pcnxl3-010; intron 2
ENSMUST00000127876 ; Pcnxl3-008; intron 6
ENSMUST00000145270 ; Pcnxl3-005; intron 9
ENSMUST00000068169 ; Pcnxl3-004; intron 13
ENSMUST00000113615 ; Pcnxl3-001; intron 15
Database links

Mature sequence mmu-miR-6987-5p

Accession MIMAT0027876
Sequence

6 - 

ugggacagggugacagggugag

 - 27

Get sequence
Deep sequencing118 reads, 41 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6987-3p

Accession MIMAT0027877
Sequence

51 - 

cacccauuucucccugcuuccag

 - 73

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).