Stem-loop sequence mmu-mir-6978

AccessionMI0022826 (change log)
Symbol MGI:Mir6978
DescriptionMus musculus miR-6978 stem-loop
Stem-loop
   aaaggaa          a       gugc 
5'        ggggugagag gaagcug    c
          |||||||||| |||||||     
3'        ucccacucuc cuucggc    a
   ---gacg          a       accu 
Get sequence
Deep sequencing
209 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 57217172-57217228 [-]
sense
OTTMUST00000110721 ; C3-002; intron 2
OTTMUST00000110723 ; C3-004; intron 3
OTTMUST00000110722 ; C3-003; intron 4
OTTMUST00000110561 ; C3-001; intron 22
ENSMUST00000177046 ; C3-002; intron 2
ENSMUST00000177425 ; C3-004; intron 3
ENSMUST00000176457 ; C3-003; intron 4
ENSMUST00000024988 ; C3-001; intron 22
Database links

Mature sequence mmu-miR-6978-5p

Accession MIMAT0027858
Sequence

6 - 

aaggggugagagagaagcuggug

 - 28

Get sequence
Deep sequencing36 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6978-3p

Accession MIMAT0027859
Sequence

35 - 

acggcuucacucucacccugcag

 - 57

Get sequence
Deep sequencing173 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).